Tel: 1-631-626-9181 (USA)    44-207-097-1828 (Europe)
  Email:

Th

Cell Type
Dopaminergic neurons
Length
3015 bp
Type
Mammalian tissue specific promoter
Sequence
CTGCTAGGGGCTGCTTCCCAGCTACTCCTCTTGGCTCCGTGGCTTGCCTTCCAGCCTGTGTGCTGTCTGGAGAGCCTTTAAAGCCTCACTTCCACCAACTAGAAGTCTCTCCCCAACCCTGCCCTGACCTCAAGTGCACCTCTTCAAAGTCAGGTTTAGCAGCTGCAGCTGGGGGCCCTGAATCCCACCCCTGCTGTCTTCCTTGAAGACAGAAGTGTTGGGAGCTGAGGATCTGGGCTAGAGACTGGCTGTATGATCCAGAGAAGTAGTGTGCTTCTGGGCCTCAGATTTCCCTTCTGTAGAACAGGTTTGTCTGAAATGGAGAGGTTGGTGCTCCTCTGCAGGGCCTAGTGGGAGTCACCATGAGTGGTTAAAAGATCCAGCTTGTCTTTTGGTGAGCTTTGAGAGGAGGTAACAGGGCTGAGTTCTGGAAGCCTGACCAAGGGCAGACTTAAGGGGCCTCTTGGAGTTGTTCTCATCAAATGGGGATGGGACACAGCTAAAGTGCCCAGGGCTTCTCTGTGCCCACAGATGCTTTAGATCTTGGCACAGTGTGGTCTACCAGCTGTCTCTCTCTGTGTATATATATGTATTTCATAGACAGTGTACAGTGGCCTGGTTTGTGCTATCAGGCTGGATATGGACAGAGGCAAGAGTTTGTGGCAGCAGTTATCTCCCAAGAGAGTCCAAAGACATCATGTTTTCAAGTTTAGGCCAGGTGCTACTTGAGAGAGCTCAGACACAGACAAAGGTCTGGAGAGCACATGTCCTCCACCCCCACCTAGCTTCTGTTGCAAGCACCTCCAGCCGAGACAAGAGAACGAATTAAAAAGCAATATTTGTGTCAGTGTAAGACATTTGCCGAAAGGTTAAATCCACATTCGTGTTGCTGCAGAGCAGCCCCCTATGCAGGATTTGTTAGATACAGCTCCGTCCTACCCTGTGCCAGCTGAGCAAACGCCAGGCTGGGTGGGGTGGAACCCAGCCTGGGTTTGCCTCACCCTGCAATCCCCCCAGCACCCTCTAAAGGAGGACCCTGTGGTGGGCATGCAGACCTAGGGACTGGGCATAGATAACCTTTGGGTTTGGGCAACAGCCCCCACTCCTCAGGATTGAAGGCTAAGGTGCAGCCAGCTCTGCCTTCATGGTGGGAATGTCTCCACGTGACCCCTTTCTGGGCTGTGGAGAACACTCAGAGAAGAGTCCTGGGATGCCAGGCAGGCCAGGGATGTGCTGGGCATGTTGAGACAGGAGTGGGCTAAGCCAGCAGAGTTGCTGACCCAGGAAGAGTTCAGAAAGGGGCATGGAACATGGGGAGGGGTCCATAGTGAGAGAGAGCAGGCAGTGCAGAGTAAATAGTCCCTGAGCTGGGGGTTATGGGATTTGCAGGAGCTTGCTCAGAGAAGGCAGAGGAGAGATGCTGCGCCAAGCTGGGTATCACAGAGCCTCAGACTCCTGGAACAGGAACTGTGGGGGTCAGGTCAGCAGGGGAGGTTAGGGAGTGTTCCCTTTGTACTGACTTAGCATTTATCCTGCTTCTAGGGGGGAAGGGGGGCCAGTGGGGGATGCACAGCAAGGCAGTGATGTGGCAGGCAGCCTGCGGGAGCTCCTGGTTCCTGGTGTGAAAAAGCTGGGAAGGAAGAGGGCTGGGTCTGGTAAGTACAGCAGGCAGTTGGCTCCTGAGAGTCCAAGCCCTGTCTAGAGGGTGGAGTGAGATTTCAGAGGGAGAGCTAAACGGGGTGGGGGCTGGGGAGTCCAGGCTTCTGGCTCCTGCTAATACTCAGTGTGCTGGGTCCTCAGAACCTCAGGGTGGCCATTTTCAGGGTGAGAGCTCTGTCCTTTGGCACTTCTGCAGACTCCAGTATCCAGAGGAATAAAGATGGTACTCTTCCTCAGTTCCCTTAGTGAGAGGACACCTTTCTCTGAAGGGCTTGGGCAGTTGTCCTGAACCATTGCCTGAAGGAAGGACTTGACTCCAGGGACATAGAATGGGCTCAGCATAAGTCCCCTGTAGTAGAGAAAGGTCCCCTCTCTGGTCTCCTTAGAGATCCTGTTTCCTTGGCTGAGGAAGCTAGGGTGGATCTTTGTGTAAGTGGGTGTGGATGCTCACTGGAAATCAAAAGGCCCCTTGGTGTTAGACCTTGGGGTGCCATGGGAGAGTTGATCACTGAGTGCGCCCTTACATGGGGGCCAGCTGAGAATGGGGCTGCCTCTAGCTCGAGACCATGATGCAGGGAGTGAGTGGGGGAGTTCAGGATACTCTTAACTAAAGCAGAGGTCTGTCCCCCCAGGGAGGGGAGGTCAGAAGACCCTAGGGAGATGCCAAAGGCTAGGGTTGGCACCATGTTGCAGGCTGTGTCTTCAAGGAGATGATAATCAGAGGAATCGAACCTGCAAAAGTGGGCCAGTCTTAGATACACTATAGAGGAATAATCTTCTGAAACATTCTGTGTCTCATAGGACCTGCCTGAGGACCCAGCCCCAGTGCCAGCACATACACTGGGGCAGTGAGTAGATAGTATACTTTGTTACATGGGCTGGGGGGACATGGCCTGTGCCCTGGAGGGGACTTGAAGACATCCAAAAAGCTAGTGAGAGGGCTCCTAGATTTATTTGTCTCCAAGGGCTATATATAGCCTTCCTAACATGAACCCTTGGGTAATCCAGCATGGGCGCTCCCATATGCCCTGGTTTGATTAGAGAGCTCTAGATGTCTCCTGTCCCAGAACACCAGCCAGCCCCTGTCTTCATGTCGTGTCTAGGGCGGAGGGTGATTCAGAGGCAGGTGCCTGCGACAGTGGATGCAATTAGATCTAATGGGACGGAGGCCTCTCTCGTCCGTCGCCCTCGCTCTGTGCCCACCCCCGCCTCCCTCAGGCACAGCAGGCGTGGAGAGGATGCGCAGGAGGTAGGAGGTGGGGGACCCAGAGGGGCTTTGACGTCAGCCTGGCCTTTAAGAGGCCGCCTGCCTGGCAAGGGCCGTGGAGACAGAACTCGGGACCACCAGCTTGCACT
Species
Mouse
Tissue
Brain

Quick Inquiry

   Please input "biogene" as verification code.